In three female strains Moby Dick, Space Queen and Copenhagen Kush- primers S22645strt 5 CCAATAACCCTCATCCCATTCC3 and S22645end 5 ATTTCCAAAAGTGTGCGATTCC3 were used to amplify beyond the region of the female 540 bp band. But even in a breeding program, you must keep your male and female plants apart. This Indica-dominant hybrid is known for its delicious cookie flavor.  Source: <a href=http://www.chillicothemo.com/list/member/abel-rosenbaum-1775>http://www.chillicothemo.com/list/member/abel-rosenbaum-1775</a>